Otc Tissue Tek

Lab Reagents

Human IgG antibody Laboratories manufactures the otc tissue tek reagents distributed by Genprice. The Otc Tissue Tek reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact tissue tek oct. Other Otc products are available in stock. Specificity: Otc Category: Tissue Group: Tek

Tek information

TEK antibody

70R-20759 50 ul
EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody

37274-100ul 100ul
EUR 252

TEK Antibody

1-CSB-PA982820
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEK Antibody

1-CSB-PA041300
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TEK Antibody

1-CSB-PA050236
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TEK Antibody

1-CSB-PA050237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TEK Antibody

1-CSB-PA023375GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-TEK

YF-PA27377 50 ug
EUR 363
Description: Mouse polyclonal to TEK

OTC Conjugated Antibody

C36670 100ul
EUR 397

OTC cloning plasmid

CSB-CL017270HU-10ug 10ug
EUR 408
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: ATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGCTTTTAGAAATGGTCACAACTTCATGGTTCGAAATTTTCGGTGTGGACAACCACTACAAAATAAAGTGCAGCTGAAGGGCCGTGACCTTCTCACTCTAAGAAACTTTACCGGAGAAGAAATTAAATATATGCTATGGC
  • Show more
Description: A cloning plasmid for the OTC gene.

OTC Polyclonal Antibody

A57433 100 µg
EUR 570.55
Description: reagents widely cited

OTC Rabbit pAb

A9834-100ul 100 ul
EUR 308

OTC Rabbit pAb

A9834-200ul 200 ul
EUR 459

OTC Rabbit pAb

A9834-20ul 20 ul
EUR 183

OTC Rabbit pAb

A9834-50ul 50 ul
EUR 223

OTC Blocking Peptide

33R-1173 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZNF177 antibody, catalog no. 70R-8252

Anti-OTC antibody

STJ111876 100 µl
EUR 277
Description: This nuclear gene encodes a mitochondrial matrix enzyme. Missense, nonsense, and frameshift mutations in this enzyme lead to ornithine transcarbamylase deficiency, which causes hyperammonemia. Since the gene for this enzyme maps close to that for Duchenne muscular dystrophy, it may play a role in that disease also.