Sakura Tissue Tek Accu Cut Srm 200 Clamping Levers

Lab Reagents

Human IgG antibody Laboratories manufactures the sakura tissue tek accu cut srm 200 clamping levers reagents distributed by Genprice. The Sakura Tissue Tek Accu Cut Srm 200 Clamping Levers reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact sakura tissue tek. Other Sakura products are available in stock. Specificity: Sakura Category: Tissue Group: Tek Accu

Tek Accu information

SRM antibody

70R-20521 50 ul
EUR 435
Description: Rabbit polyclonal SRM antibody

SRM Antibody

1-CSB-PA022668DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRM. Recognizes SRM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SRM Antibody

1-CSB-PA022668GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SRM. Recognizes SRM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

SRM Antibody

1-CSB-PA01115A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SRM. Recognizes SRM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SRM siRNA

20-abx935162
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SRM siRNA

20-abx935163
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

InstantAgarose?, Agarose Tablet, 0.5g, 200 tabs, blister convenient pack

R9012TAB-200
EUR 163

PureSaver Tissue RNA Storage Solution

R6202-200 10X10ml
EUR 232

ODN 2007-Type B bovine/porcineTLR9 agonist-antigen grade, 200 ug

ODN2007-200 200 ug Ask for price

SRM Polyclonal Antibody

31454-100ul 100ul
EUR 252

SRM Polyclonal Antibody

31454-50ul 50ul
EUR 187

SRM cloning plasmid

CSB-CL022668HU-10ug 10ug
EUR 364
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atggagcccggccccgacggccccgccgcctccggccccgccgccatccgcgagggctggttccgcgagacctgcagcctgtggcccggccaggccctgtcgctgcaggtggagcagctgctccaccaccggcgctcgcgctaccaggacatcctcgtcttccgcagtaagaccta
  • Show more
Description: A cloning plasmid for the SRM gene.

SRM Rabbit pAb

A8151-100ul 100 ul
EUR 308

SRM Rabbit pAb

A8151-200ul 200 ul
EUR 459

SRM Rabbit pAb

A8151-20ul 20 ul
EUR 183

SRM Rabbit pAb

A8151-50ul 50 ul
EUR 223

SRM Polyclonal Antibody

A53881 100 µg
EUR 570.55
Description: fast delivery possible