Lab Reagents

Human IgG antibody Laboratories manufactures the sakura tissue tek 5 emb reagents distributed by Genprice. The Sakura Tissue Tek 5 Emb reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact sakura tissue tek. Other Sakura products are available in stock. Specificity: Sakura Category: Tissue Group: Tek 5

Tek 5 information

EMB Rabbit pAb
A10423-200ul	Abclonal	200 ul	EUR 459

EMB Rabbit pAb
A10423-20ul	Abclonal	20 ul	EUR 183

EMB Rabbit pAb
A10423-50ul	Abclonal	50 ul	EUR 223

Embigin (EMB) Antibody
20-abx125809	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Embigin (EMB) Antibody
20-abx318809	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Embigin (EMB) Antibody
abx232751-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

EMB cloning plasmid
CSB-CL754239HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 984 Sequence: atgcgcgccctccccggcctgctggaggccagggcgcgtacgccccggctgctcctcctccagtgccttctcgctgccgcgcgcccaagctcggcggacggcagtgccccagattcgccttttacaagtccacctctcagagaagaaataatggcaaataacttttccttggagag Show more
Description: A cloning plasmid for the EMB gene.

Mouse Embigin (Emb)
1-CSB-CF007631MO	Cusabio	EUR 1284.00 EUR 558.00 EUR 815.00	1MG 200ug 500ug
MW: 36.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Embigin(Emb) expressed in in vitro E.coli expression system

anti- EMB antibody
FNab02751	FN Test	100µg	EUR 548.75
Immunogen: embigin homolog(Mouse) Uniprot ID: Q6PCB8 Gene ID: 133418 Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against EMB

Anti-EMB antibody
PAab02751	Lifescience Market	100 ug	EUR 386

Anti-EMB antibody
STJ112455	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1.

Frozen Tissue Array - Human Tumor and Normal Tissue, Multi-tissue I
T6235700-5	Biochain	5 slides	EUR 1168
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

TEK antibody
70R-20759	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody
37274-100ul	SAB	100ul	EUR 252

TEK Antibody
1-CSB-PA050236	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TEK Antibody
1-CSB-PA050237	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TEK Antibody
1-CSB-PA982820	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200