Sakura Tissue Tek 5 Emb

Lab Reagents

Human IgG antibody Laboratories manufactures the sakura tissue tek 5 emb reagents distributed by Genprice. The Sakura Tissue Tek 5 Emb reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact sakura tissue tek. Other Sakura products are available in stock. Specificity: Sakura Category: Tissue Group: Tek 5

Tek 5 information

Embigin (EMB) Antibody

abx232751-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

EMB Rabbit pAb

A10423-100ul 100 ul
EUR 308

EMB Rabbit pAb

A10423-200ul 200 ul
EUR 459

EMB Rabbit pAb

A10423-20ul 20 ul
EUR 183

EMB Rabbit pAb

A10423-50ul 50 ul
EUR 223

EMB Polyclonal Antibody

27429-100ul 100ul
EUR 252

EMB Polyclonal Antibody

27429-50ul 50ul
EUR 187

Mouse Embigin (Emb)

1-CSB-CF007631MO
  • EUR 1284.00
  • EUR 558.00
  • EUR 815.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 36.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Embigin(Emb) expressed in in vitro E.coli expression system

EMB cloning plasmid

CSB-CL754239HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 984
  • Sequence: atgcgcgccctccccggcctgctggaggccagggcgcgtacgccccggctgctcctcctccagtgccttctcgctgccgcgcgcccaagctcggcggacggcagtgccccagattcgccttttacaagtccacctctcagagaagaaataatggcaaataacttttccttggagag
  • Show more
Description: A cloning plasmid for the EMB gene.

Anti-EMB antibody

PAab02751 100 ug
EUR 386

Anti-EMB antibody

STJ112455 100 µl
EUR 277
Description: This gene encodes a transmembrane glycoprotein that is a member of the immunoglobulin superfamily. The encoded protein may be involved in cell growth and development by mediating interactions between the cell and extracellular matrix. A pseudogene of this gene is found on chromosome 1.

Frozen Tissue Array - Human Tumor and Normal Tissue, Multi-tissue I

T6235700-5 5 slides
EUR 1168
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

TEK siRNA

20-abx936459
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TEK antibody

70R-20759 50 ul
EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody

37274-100ul 100ul
EUR 252

TEK Antibody

1-CSB-PA982820
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEK Antibody

1-CSB-PA041300
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100